circad | circRNAs associated with diseases

hsa_circ_0008309
Gene	CUL3	Organism	Human
Genome Locus	chr2:225400244-225422573:-	Build	hg19
Disease	Oral Squamous Cell Carcinoma	ICD-10	Carcinoma in situ of oral cavity, oesophagus and stomach (D00)
DBLink	Link to database	PMID	30344795
Experimental Method
Sample Type	Tissues	Comparison	45 pairs of frozen OSCC tissues and adjacent normal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AC AGCTATGGTGATGATTAGAGACA Reverse TCAGAAGGTCCCAAATGCTGTT	Statistics	Fold Change : Upregulated pvalue : p<0.023438
Citation
Li, B, Wang, F, Li, X, Sun, S, Shen, Y, Yang, H (2018). Hsa_circ_0008309 May Be a Potential Biomarker for Oral Squamous Cell Carcinoma. Dis. Markers, 2018:7496890.